Scientific Research Projects

Project name/Short description Project type Posted time Budget
searching google.com/patents
You will match a given patent publication's details to specific parts of prior publications found in google.com/patents. This is just a general description. More information will be provided once you show interest in the position. You need to be good at reading, comprehension, following directions in English. and critical thinking. You will need Skype. Bids over $100 will not be considered. There are ... Full details »
2 days ago$30 - 250
article download
Hello! I need an articles, the total amount is 38, see the attachment. Please provide a few pages from one of the articles as an example. USD 5 milestone, PayPal is preffered. Best regards Full details »
3 days ago$30 - 45
Copy paste easy job only Need excellent Research SKills
HI, Please try to understand that the project is not for time wasters. Please try to understand that the project is not for time wasters. If you do not update me in every 3-4 hours do not bid on this project. Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! I need some excellent research person who is able to search in internet and can provide what I want.,I will provide ... Full details »
4 days ago$30 - 250
Research on FertilityTreatment Options in Israel
We are a couple in our upper 40s seeking to have a biological child using our own egg rather than a donor egg. We have heard that there may be technologically advanced fertility treatment options available in Israel. We are interested in what options might be available in Israel for assisted reproductive therapy (ART), and specifically therapies that have a track record of above-average results with ... Full details »
4 days ago$30 - 250
1-2 page report on approDevelop simplistic simulation model,
The final product should be a report on development of simulation forecast model which is based on the logistic regression. This report can be two pages. In the report: the information on evaluation of the model performance using the measurements of logistic regression. First, the month with the highest phenomena occurrence should be selected. • Using the logistic regression built in SAS software ... Full details »
5 days ago$30 - 250
Develop simplistic simulation model,1-2 page report on appro
We have the data set with variables describing the natural phenomena for the long time period. The variable are for each hour of the day. First task, is to select the month for the most occurrence of the phenomena. Then, base on the steps outlined below, to develop the logistic regression model. The most important, to display the steps how to develop this model, how to evaluate this model. How ... Full details »
6 days ago$30 - 250
chemical modelling-12418
***************Deadline:Within 2 days after confirmation*************** Please use Harvard Referencing and Plagiarism free content. Assignment details: Make the VB code in file nu1.xlsm generic, and run several iterations for Kc and Ti to find out the optimal combination which will result in minimum error value and convergence. The process coef. a and b in equation y = a * y + b * u will be 0.7 ... Full details »
1 week ago$30 - 30
Analyses of HIV prevention in the education system
Analyses of 50 articles (see the attached files) in the field of HIV prevention in the education system submitted previously - the volume of 20-25 pages. 1. To make a list of 50 articles submitted previously (see the attached files). In the list there are to be mentioned for each source (article): - who made the research; - what did the researcher do in brief; - what are the results. 2. To analyze ... Full details »
1 week ago$250 - 750
Articles - 10,000 words total (25-30 articles)
This project is for articles to fill a new website. The subject is "Molecular Mixology" Total words - 10,000 varied length articles between 300-500 words Must be 100% unique and well written Should be a mix of recipes, techniques, ideas, product reviews, events etc - but should be a balance of all of these. The articles will form an informative reference guide for the website. A google search ... Full details »
1 week ago$30 - 250
ANOVA Analysis / Test Needed for sample data with DOC
I need ANOVA analysis of data I will give, with the use of Excel. Also a very detailed documentation/report of every step taken will be needed. So what you did, what was the result and what was it for and what will it be used for etc, with screens from Excel. Before the ANOVA analysis: -Draw the boxplot s of all samples, detect the outliers using one of the existing methodsnand remove them from ... Full details »
2 weeks ago$30 - 250
Market Research
Conduct surveys for effective data collection through face-to-face/telephonic interviews with the hospital staffs concerned. The hospitals can be from any Indian cities of your choice. Professionals in the following positions are preferred: Medical representatives,Staff nurse,Hospital technician,Sales representatives (medical devices),Final year medical /nursing students,Medical doctors,Medical insurance ... Full details »
2 weeks ago$250 - 750
Private project for RfPhD
A writing and research project. Helping with the economics and demographics paper. Saw samples of RfPhD work before and would like to see the same quality. Full details »
2 weeks ago$750 - 1500
MATLAB - TOP URGENT - 12 HOURS - 12270
******** DO ASSIGNMENT 2 PART B ****************** DEADLINE 13th 2 PM INDIA TIME I have attached assignment and regarding information. This is an Monash University Clayton, "Electrical and computer system engineering" based assignment. Unit name: ECE3093: Optimisation estimation and numerical methods. It's a Matlab coding assignment. There have some variables assign for each student. Which ... Full details »
2 weeks ago$60 - 90
Copy paste easy job only Need excellent Research SKills
HI, Please try to understand that the project is not for time wasters. Please try to understand that the project is not for time wasters. If you do not update me in every 3-4 hours do not bid on this project. Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! I need some excellent research person who is able to search in internet and can provide what I want.,I will provide ... Full details »
2 weeks ago$250 - 750
Wireless Data Acquisition using PSoC
I need help designing and testing a two-channel, wireless data acquisition device using Cypress Semiconductor's PSoC 3/5 chips. Analog data will be acquired using the PSoC and transmitted to a PC via Bluetooth.The PC will send acquisition parameters to the PSoC via Bluetooth. Both hardware and simple software will need to be designed and tested. Device will need only be tested on a Cypress development ... Full details »
2 weeks ago$200 - 1000
CHEMISTRY - NEED IN 6 HOURS -
ALL DETAILS MENTIONED IN THE ATTACHMENT NEED THE WORK IN SHARP 6 HOURS PLS CONFIRM ONLY IF YOU ARE 100% CONFIDENT OF DELIVERY IN 6 HOURS Full details »
2 weeks ago$40 - 50
Biochemistry Clinical Case Study URGENT!!!
I need someone with background in science or with biochemistry knowledge to read a biochemistry clinical case study, then do a research of the case study, and complete a case study report of 5-7 pages of text outlining the background to this case, the clinical features, the tests performed, the results obtained, and the biochemical basis for Vanessa’s condition. Please see details here: Research ... Full details »
2 weeks ago$30 - 300
someone with experience in GIS ArcView 3.2
I have a Climate Change project that uses GIS software, ArcView 3.2 with WetSpass module installed. I need an engineer, geologyst or an science major person with scientific experience in this subject to help me out with some tasks. Experience with GIS, ArcView 3.2 is a big plus, but I'm welling to work with someone who has some experience close to the subject. Please contact me for further details ... Full details »
3 weeks ago$750 - 1500
Copy paste easy job only Need excellent Research SKills
HI, Please try to understand that the project is not for time wasters. Please try to understand that the project is not for time wasters. If you do not update me in every 3-4 hours do not bid on this project. Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! I need some excellent research person who is able to search in internet and can provide what I want.,I will provide ... Full details »
3 weeks ago$30 - 250
Copy paste easy job only Need excellent Research SKills
HI, Please try to understand that the project is not for time wasters. Please try to understand that the project is not for time wasters. If you do not update me in every 3-4 hours do not bid on this project. Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! I need some excellent research person who is able to search in internet and can provide what I want.,I will provide ... Full details »
3 weeks ago$30 - 40
someone with experience in GIS ArcView 3.2
I have a Climate Change project that uses GIS software, ArcView 3.2 with WetSpass module installed. I need an engineer, geologyst or an science major person with scientific experience in this subject to help me out with some tasks. Experience with GIS, ArcView 3.2 is a big plus, but I'm welling to work with someone who has some experience close to the subject. Please contact me for further details ... Full details »
3 weeks ago$30 - 250
Copy paste easy job only Need excellent Research SKills
HI, Please try to understand that the project is not for time wasters. Please try to understand that the project is not for time wasters. If you do not update me in every 3-4 hours do not bid on this project. Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! Copy paste Job!!! I need some excellent research person who is able to search in internet and can provide what I want.,I will provide ... Full details »
3 weeks ago$30 - 250
Genome assembly software
I need a a software for genome assembly based on an algorithm of mine. In genome assembly the software is given millions of strings (reads) and merges two strings based on some detected overlap between them. For example: AAGTTAAATGAGA and GTTCCCAAGTTAA will merge into: GTTCCCAAGTTAAAAGTTAAATGAGA because AAGTTAA is a an overlapping string between them. So basically, for every set of strings with overlap ... Full details »
3 weeks ago$750 - 1500
Planetary presentation
15 minute presentation on a topic related to planetary. the presentation must be presented on powerpoint slides. My budget is $30. Please bid and I will message you the specific topic/ title of the presentation. The project must be submitted within 24 hours. Full details »
3 weeks ago$30 - 30
Spanish-English technical translation food safety field
I need translation for a project from Spanish to English. It is a project for a competitive international found so I need excellent technical and academic Spanish English translation. The project is in the Food Safety area, so is necessary to have the vocabulary back ground. We also need a translator that have the opposite time zone or than can deliver the work over night (12 hours). Is not long 3-4 ... Full details »
3 weeks ago$30 - 250
Reference Paper for Power Electronics
Requires reference paper for the matlab simulink model in the link and files attached. I tried various means to find the papers online but to no avail. Any experts out there interested to help me source for the papers are welcome. http://www.mathworks.com/matlabcentral/fileexchange/30961-variable-frequency-180-degree-conduction-based-three-phase-simple-pwm-inverter Full details »
3 weeks ago$30 - 50
Spanish-English technical translation food safety field
I need translation for a project from Spanish to English. It is a project for a competitive international found so I need excellent technical and academic Spanish English translation. The project is in the Food Safety area, so is necessary to have the vocabulary back ground. We also need a translator that have the opposite time zone or than can deliver the work over night (12 hours). Is not long 3-4 ... Full details »
4 weeks ago$30 - 250
ieee papers downloading service avaliable
if any one wants IEEE JOURNAL papers, we will download papers and sent to you ,price is per paper basis Full details »
4 weeks ago$12500 - 37500
Research data on load factors for diff countries over time
We want to derive load factors (electrical) over time for a number of countries and the data we need for this is delivered power (twh) and installed capacity (gw) over time. In terms of time period, it can be whatever historical information is available. In terms of countries, we are interested in the US, Japan, Australia, Germany and India. (However, ideally we'd like as large a sample of countries ... Full details »
4 weeks ago$30 - 250
documentation about control of linear time delay systems
I need documentation or help about control of linear time delay systems using lyapunov krasovskii approach by resolving LMI. 1-Desgning a state feedback control law for linear time delay systems, how to find the LMI and how to resolve it. 2-Designing an observer based controller for a linear time delay system when one state is not available, how to find the corresponding LMI and how to resolve it. Any ... Full details »
4 weeks ago$30 - 40
aqm simulations on simulink using LMI issued from Lyapunov k
Don't bid high for this project because if you are familiar with this it is very easy to do. I attached some pdf files and a word document as a project description for the system you will use. First, in the document named Science you’ll find the same project requirements (They designed a state feedback controller and an observer based controller) BUT they used a model where the delay is present only ... Full details »
4 weeks ago$30 - 100
UID - Face Recognition without Facial Surface Reconstruction
Hello, I need a mathematic solution to create a unique id for faces, each face has one UID Number, no comparison with pictures, if this software has see the picture it's generate the UID. A good example is a picture of Tom Hanks Actor, we try the software loading many pictures of Tom Hanks and the software return only one UID, the UID of Tom Hanks. The same case if a put many pictures of Mel Gibson, ... Full details »
4 weeks ago$1500 - 3000
Data Entry and Research
Data Entry and Data Mining is needed. please reply to this post if interested if you are able to begin task today. Skills: - English - Data Entry - Data Mining - MS Word/Excel - Fast typing speed - Fast Internet Connection Full details »
4 weeks ago$15 - 25
Data Entry and Research
Data Entry and Data Mining is needed. please reply to this post if interested if you are able to begin task today. Skills: - English - Data Entry - Data Mining - MS Word/Excel - Fast typing speed - Fast Internet Connection Full details »
4 weeks ago$3000 - 5000
SPSS Anlaysis
There is a Survey of 150 questionnaires and 450 respondents. Data results are ready in excel file, Data results are showing Mean, Standard Dev., and Variance Need to complete the Finding and Analysis part of a dissertation using the SPSS Software. I have got the survey questions and i need someone to analyze the results and make graphs/tables in SPSS. Full details »
4 weeks ago$30 - 75
English into Ukrainian translation
I need to translate into Ukrainian as soon as possible 30 pages of chemistry text chapter. The brief annotation of chapter in Ukrainian can be given in help. Oleksandr Full details »
4 weeks ago$30 - 250
BIOTECHNOLOGY - bioinformatics - GENE SEQUENCING - 11616
ALL THE DETAILS ARE GIVEN IN THE ATTACHMENT ********DEADLINE : 27th APRIL - 11PM - INDIA STANDARD TIME************ WORK SHOULD BE PLAGIARISM FREE AND ACCURATE Full details »
4 weeks ago$30 - 40
CHEMISTRY - 11584
ALL THE QUESTIONS ARE MENTIONED IN THE PDF FILE ATTACHED DEADLINE: 28TH APRIL 11 PM - INDIA STANDARD TIME ALL ANSWERS MUST BE 95-100% CORRECTION Full details »
4 weeks ago$30 - 30
Need Medical Questions
I need a database of 10,000 multiple choice exam questions covering the following areas: Internal Medicine Obstetrics and Gynaecology Paediatrics Surgery The questions should be more oriented towards tropical medical practice, covering 2,500 questions for each specialty. There is the option of further work if this goes well. NB: The question should be divided into multiple-choice questions from ... Full details »
4 weeks ago$30 - 250
URGENT : required professional article writer in 24Hrs!
PLEASE CHECK THE ATTACHMENT BEFORE YOU BID =============================================== Please read this carefully, Need a good academic writer with writing experience in business field for longterm relationship. Requirements: 1. To write article about ( Assessment of operations of a selected firm operating in UAE ) 2- The article should be (2500 and sighting and references) 3- article ... Full details »
1 month ago$30 - 50
Research Work - Physics
Hello, I need a physicist for a research work. Order Instructions Topic: your own ideas/it need to be something what is good enough for a publication in one of the international physics-journals Level: PhD or higher (not physicist with diploma. An PhD is absolutely required) Pages: Between 13 and 20 pages. Time: If you're an good physicist with PhD, I'll give you up to 1 month time. If you ... Full details »
1 month ago$250 - 750
URGENT - Chemistry - only Q 7,8,9 - 11427
ONLY Q 7,8,9 NEED IN 12 HOURS all the details are mentioned in the pdf its about chemistry pls check the file for all the details Full details »
1 month ago$30 - 30
fish production in different asian countries
Fish is a important source of animal protein for human being. So it is important to see the level of fish production in the world. Many Asian countries are rich with their fishery resorces. They are exporting fish to UK, USA, UAE. As I am from Bangladesh , my project is to find out the level of fish production in different Asian countries. The data will also provide the percentage of local consumption ... Full details »
1 month ago$250 - 750
channel estimation in OFDM
Hello sir, need a matlab programmer who knows the montecarlo simulations in matlab. there is a file attached. you just have to cut short the paper and rewrite it and make a brand new research paper.you should be knowing the matlab coding. because you also have to do the montecarlo simulations for any 2 of the figures in shown in the original paper.so ultimately you gonna give me two files. 1. new research ... Full details »
1 month ago$250 - 750
Research paper
Research paper needed in the area of Combinatorial optimization problems. Sound knowledge of academic and technical writing are highly essential. Must have PhD in computer sc, or Mathematics or other related discipline. MATLAB knowledge is mandatory for coding and simulation Full details »
1 month ago$30 - 250
Any Topic on Chemistry for Advanced Degree (MS) Seminar
I need someone to help out to write an excellent summary and presentation about any recent topic in chemistry. The following are the requirements: 1. The topic of the presentation has to be recent (last two years) and not related to the student's research topic. 2. The student has to submit two topics. The student is advised to search in highly reputed journals like J. Am. Chem. Soc. or Angew Chem ... Full details »
1 month ago$30 - 250
Urgent-AQM simulation on matlab using LMI lyapunov krasvskii
Don't bid high for this project because if you are familiar with this it is very easy to do. I attached some pdf files and a word document as a project description for the system you will use. First, in the document named Science you’ll find the same project requirements (They designed a state feedback controller and an observer based controller) BUT they used a model where the delay is present only ... Full details »
1 month ago$30 - 100
Chemical Engineering University Dissertation
The project consists of three parts 3000 words written essay. A3 poster A power point presentation to use for a 10 Minuit oral presentation on the topic The question to answer is "Can we predict the likelihood of powders caking even before they occur?" I have attached two files one with the writing criteria for the written essay and another with some information i have gathered myself ... Full details »
1 month ago$30 - 250
Biochemical Engineering - Spatial Science - 11310
Introduction to Engineering and Spatial Science Applications All the details are in the attached file *********IMPORTANT************* The work must be plagiarism free *********IMPORTANT************* Need the completed work by 11 am on 24th April Full details »
1 month ago$30 - 40
Chemical engineering - need in sharp 12 hours - 11382
Please note that for Question 1 (part e), you need to provide the value of the new dynamic head when we consider the fittings. The storage tank in Question 1 is open to the atmosphere (as drawn). Also please indicate the sources of your resistance coefficients that you use (especially if you do not use the minor losses data sheets). Full details »
1 month ago$30 - 35
« Previous 1 2 3 4 5 6 7 8 9 10 ... 13 14 Next » Show All

Premium Sponsor